(cache)NCBI Blast:Nucleotide Sequence

Save Search

Search Parameters
Search parameter name	Search parameter value
Program	blastn
Word size	28
Expect value	0.05
Hitlist size	100
Match/Mismatch scores	1,-2
Gapcosts	0,2.5
Low Complexity Filter	Yes
Filter string	L;m;
Genetic Code	1

Database
Database parameter name	Database parameter value
Posted date	Sep 30, 2025 11:25 PM
Number of letters	955,875,519,808
Number of sequences	119,091,511
Entrez query	Includes: Excludes: None

Karlin-Altschul statistics
Params	Ungapped	Gapped
Lambda	1.33271	1.28
K	0.620991	0.46
H	1.12409	0.85

Results Statistics
Results Statistics parameter name	Results Statistics parameter value
Length adjustment	34
Effective length of query	116
Effective length of database	951826408434
Effective search space	110411863378344
Effective search space used	110411863378344

Job Title

Nucleotide Sequence ...

RID

JV6ETGUA016 Search expires on 12-02 20:36 pm

Download All

Results for

Program

BLASTN

Citation
Reference
Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14.
Reference - database indexing
Aleksandr Morgulis, George Coulouris, Yan Raytselis, Thomas L. Madden, Richa Agarwala, Alejandro A. Schäffer (2008), "Database Indexing for Production MegaBLAST Searches", Bioinformatics 24:1757-1764.

Database

core_nt

See details

Title:Core nucleotide BLAST database
Description:The core nucleotide BLAST database consists of GenBank+EMBL+DDBJ+PDB+RefSeq sequences, but excludes EST, STS, GSS, WGS, TSA, patent sequences as well as phase 0, 1, and 2 HTGS sequences and most eukaryotic chromosome sequences. The database is non-redundant. Identical sequences have been merged into one entry, while preserving the accession, GI, title and taxonomy information for each entry.
Molecule Type:mixed DNA
Update date:2025/10/05
Number of sequences:119087540

Query ID

lcl|Query_7511437

Description

None ...

Molecule type

dna

Query Length

150

Other reports

Distance tree of results MSA viewer

Filter Results

Descriptions

select all
100 sequences selected

, Reading indexes 1-5, displaying indexes 1-5, Reading indexes 6-10, displaying indexes 6-10

Sequences producing significant alignments:
Select for downloading or viewing reports	Description	Scientific Name	Common Name	Taxid	Max Score	Total Score	Query Cover	E value	Per. Ident	Acc. Len	Accession
1Select seq OV196492.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	115	231	47%	2e-21	95.83%	30243	OV196492.1
2Select seq OV196890.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	110	110	47%	8e-20	94.44%	30101	OV196890.1
3Select seq OV196022.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	110	110	47%	8e-20	94.44%	30562	OV196022.1
4Select seq OV195847.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	110	110	47%	8e-20	94.44%	30308	OV195847.1
5Select seq LC529901.1	Asarum satsumense chloroplast DNA, nearly complete sequence	Asarum satsumense	NA	76106	110	276	47%	8e-20	94.44%	164607	LC529901.1
6Select seq OV196009.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	110	220	47%	8e-20	94.44%	30101	OV196009.1
7Select seq OV196626.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	110	179	47%	8e-20	94.52%	30095	OV196626.1
8Select seq OV015804.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	106	106	47%	1e-18	93.24%	29996	OV015804.1
9Select seq LC768500.1	Klebsiella phage phiKp_32 DNA, complete genome	Klebsiella phage phiKp_32	NA	2979986	106	106	45%	1e-18	94.29%	251460	LC768500.1
10Select seq OV196177.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.15%	30003	OV196177.1
11Select seq AP040921.1	Klebsiella pneumoniae d1-42 plasmid pd1-42_D DNA, complete genome	Klebsiella pneumoniae	NA	573	104	104	47%	4e-18	93.06%	154702	AP040921.1
12Select seq OV196107.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	282	47%	4e-18	93.06%	30511	OV196107.1
13Select seq OV195202.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.15%	30221	OV195202.1
14Select seq OV195924.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30333	OV195924.1
15Select seq MK310228.1	Bacillus phage vB_BthP-HD73phi, complete genome	Bacillus phage vB_BthP-HD73phi	NA	2500580	104	207	47%	4e-18	93.06%	25867	MK310228.1
16Select seq OV196275.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	209	47%	4e-18	93.15%	30423	OV196275.1
17Select seq OV196298.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30559	OV196298.1
18Select seq OV196026.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	209	47%	4e-18	93.15%	30121	OV196026.1
19Select seq OV197539.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30057	OV197539.1
20Select seq OV197136.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30102	OV197136.1
21Select seq OV195107.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	209	47%	4e-18	93.06%	30103	OV195107.1
22Select seq OV197189.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30094	OV197189.1
23Select seq AP040934.1	Escherichia coli d1-73 DNA, complete genome	Escherichia coli	NA	562	104	209	47%	4e-18	93.06%	5088487	AP040934.1
24Select seq AP040949.1	Klebsiella pneumoniae e1-38 DNA, complete genome	Klebsiella pneumoniae	NA	573	104	104	47%	4e-18	93.06%	4868868	AP040949.1
25Select seq LC566215.1	Enterococcus faecium EV0426-12 plasmid pIHVA-EV0426-12 DNA, complete sequence	Enterococcus faecium	NA	1352	104	104	47%	4e-18	93.06%	109115	LC566215.1
26Select seq OV197600.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30105	OV197600.1
27Select seq OV195597.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.06%	30117	OV195597.1
28Select seq OV195277.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	104	104	47%	4e-18	93.15%	30090	OV195277.1
29Select seq MT157331.1	Macacine betaherpesvirus 3 strain UCD59, complete genome	macacine betaherpesvirus 3	Rhesus cytomegalovirus	47929	104	104	47%	4e-18	93.06%	225338	MT157331.1
30Select seq OM892756.1	Cecropia pachystachya isolate W55 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence	Cecropia pachystachya	NA	1472306	104	280	47%	4e-18	93.15%	5780	OM892756.1
31Select seq LS992247.1	Human gammaherpesvirus 4 isolate Human herpesvirus 4 genome assembly, chromosome: I	human gammaherpesvirus 4	Epstein-Barr virus	10376	102	162	45%	1e-17	94.12%	171493	LS992247.1
32Select seq XM_013494305.1	Eimeria mitis uncharacterized protein (EMH_0029470), partial mRNA	Eimeria mitis	NA	44415	102	102	45%	1e-17	94.12%	2355	XM_013494305.1
33Select seq MH883760.1	Human gammaherpesvirus 4 isolate ebv14, partial genome	human gammaherpesvirus 4	Epstein-Barr virus	10376	102	162	45%	1e-17	94.12%	169296	MH883760.1
34Select seq BK066886.1	MAG TPA_asm: Maldvirus fossil29388 isolate Mald29388 genomic sequence	Maldvirus fossil29388	NA	3116700	102	102	47%	1e-17	92.96%	29388	BK066886.1
35Select seq OV016108.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	100	201	47%	5e-17	91.89%	30390	OV016108.1
36Select seq OV264044.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	100	100	47%	5e-17	91.89%	30466	OV264044.1
37Select seq OV016109.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	100	100	47%	5e-17	91.89%	30090	OV016109.1
38Select seq OV196099.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	99.0	99.0	47%	2e-16	91.67%	30100	OV196099.1
39Select seq OV197187.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	99.0	196	47%	2e-16	91.78%	30208	OV197187.1
40Select seq OV196000.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	99.0	99.0	47%	2e-16	91.67%	30106	OV196000.1
41Select seq MW477480.1	Bacillus phage Whiting18, complete genome	Bacillus phage Whiting18	NA	2803381	99.0	159	47%	2e-16	91.67%	19548	MW477480.1
42Select seq AK443485.1	Conus episcopatus mRNA, sequence id; Ep642-SF13	Conus episcopatus	NA	88764	99.0	99.0	51%	2e-16	89.87%	231	AK443485.1
43Select seq KY965816.2	Lasthenia californica chloroplast	Lasthenia californica	NA	149440	99.0	593	47%	2e-16	91.78%	151993	KY965816.2
44Select seq OV196488.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	99.0	99.0	47%	2e-16	91.67%	30094	OV196488.1
45Select seq OV196584.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	99.0	99.0	47%	2e-16	91.67%	30066	OV196584.1
46Select seq AP027461.1	Escherichia coli str. K-12 substr. MG1655 D41c DNA, complete genome	Escherichia coli str. K-12 substr. MG1655	NA	511145	99.0	197	47%	2e-16	91.67%	2600243	AP027461.1
47Select seq MK249308.1	Salmonella phage TS13, complete genome	Salmonella phage TS13	NA	2500149	99.0	99.0	43%	2e-16	93.94%	59168	MK249308.1
48Select seq MN646770.1	MAG: Diabrotica undecimpunctata virus 1, complete genome	Diabrotica undecimpunctata virus 1	NA	2723963	97.1	97.1	46%	6e-16	91.78%	10483	MN646770.1
49Select seq PP943425.1	Orf virus isolate FX10, partial genome	Orf virus	NA	10258	97.1	157	44%	6e-16	92.65%	127637	PP943425.1
50Select seq CP107088.1	Yersinia enterocolitica strain Gp200 chromosome	Yersinia enterocolitica	NA	630	95.3	95.3	41%	2e-15	93.75%	4530554	CP107088.1
51Select seq OV196467.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	95.3	95.3	45%	2e-15	91.43%	30053	OV196467.1
52Select seq OV195900.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	93.5	93.5	45%	8e-15	91.43%	30109	OV195900.1
53Select seq OV196273.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	93.5	93.5	47%	8e-15	90.54%	30444	OV196273.1
54Select seq KY555145.1	Caulobacter phage Ccr29, complete genome	Caulobacter phage Ccr29	NA	1959737	93.5	93.5	41%	8e-15	93.55%	229319	KY555145.1
55Select seq NC_034747.1	Fargesia denudata chloroplast, complete genome	Fargesia denudata	NA	1306438	91.6	91.6	47%	3e-14	90.28%	133730	NC_034747.1
56Select seq OV377758.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	89.8	47%	1e-13	89.19%	30273	OV377758.1
57Select seq LS991521.1	Moina brachiata genomic DNA containing mtDNA region, isolate DE-FRO-2-1	Moina brachiata	NA	675436	87.9	175	47%	4e-13	93.33%	16307	LS991521.1
58Select seq CP094103.1	Helicobacter pylori strain Hpfe077 chromosome, complete genome	Helicobacter pylori	NA	210	87.9	87.9	43%	4e-13	91.04%	1624315	CP094103.1
59Select seq AP038805.1	MAG: Nitrospira sp. AFB01 DNA, complete genome	Nitrospira sp.	NA	70125	86.1	86.1	42%	1e-12	90.77%	4565847	AP038805.1
60Select seq OV197487.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	84.2	84.2	41%	5e-12	90.77%	30104	OV197487.1
61Select seq OY629453.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	82.4	82.4	37%	2e-11	92.98%	29842	OY629453.1
62Select seq OY648812.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	82.4	82.4	37%	2e-11	92.98%	29836	OY648812.1
63Select seq KT895861.1	Gossypium raimondii isolate Gr291 retrotransposon Ty3, complete sequence	Gossypium raimondii	Peruvian cotton	29730	82.4	82.4	39%	2e-11	91.67%	1708	KT895861.1
64Select seq OY655439.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	80.5	80.5	38%	6e-11	91.67%	29858	OY655439.1
65Select seq OY684664.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	80.5	80.5	38%	6e-11	91.67%	29620	OY684664.1
66Select seq OY702104.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	78.7	78.7	33%	2e-10	94.23%	29850	OY702104.1
67Select seq OQ808567.1	Diaporthe negative-stranded RNA virus 1 isolate SO4 9A, complete genome	Diaporthe negative-stranded RNA virus 1	NA	3035782	78.7	78.7	43%	2e-10	88.06%	9372	OQ808567.1
68Select seq NC_047813.1	Staphylococcus phage Andhra, complete genome	Staphylococcus phage Andhra	NA	1958907	75.0	135	35%	3e-09	92.45%	18546	NC_047813.1
69Select seq OY706291.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	75.0	75.0	34%	3e-09	92.45%	29724	OY706291.1
70Select seq OY708460.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	73.1	73.1	35%	1e-08	90.91%	29567	OY708460.1
71Select seq OY684713.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	73.1	73.1	33%	1e-08	92.31%	29858	OY684713.1
72Select seq OY716713.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	73.1	73.1	33%	1e-08	92.31%	29832	OY716713.1
73Select seq OY649758.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	73.1	73.1	33%	1e-08	92.31%	29828	OY649758.1
74Select seq OY699857.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	73.1	73.1	33%	1e-08	92.31%	29861	OY699857.1
75Select seq ON551388.1	Mycolicibacterium phage Kashi_SSH1, complete genome	Mycolicibacterium phage Kashi_SSH1	NA	2951410	71.3	71.3	31%	4e-08	93.75%	155659	ON551388.1
76Select seq JX069762.1	Cloning vector pFosill-2, complete sequence	Cloning vector pFosill-2	NA	1206908	71.3	71.3	42%	4e-08	86.76%	9902	JX069762.1
77Select seq AP031498.1	Maricurvus nonylphenolicus KU41E DNA, complete genome	Maricurvus nonylphenolicus	NA	1008307	71.3	71.3	29%	4e-08	95.45%	5624926	AP031498.1
78Select seq OY702345.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	71.3	71.3	33%	4e-08	92.16%	29841	OY702345.1
79Select seq OY709493.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	69.4	69.4	34%	1e-07	90.57%	29851	OY709493.1
80Select seq OY712147.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	69.4	69.4	36%	1e-07	89.66%	29824	OY712147.1
81Select seq OU509537.1	Klebsiella pneumoniae phage strain 5899STDY8049230 genome assembly, chromosome: 1	Klebsiella pneumoniae phage	NA	1915306	69.4	69.4	34%	1e-07	90.57%	58588	OU509537.1
82Select seq OY694677.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	69.4	69.4	34%	1e-07	90.57%	29897	OY694677.1
83Select seq OY637518.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	69.4	69.4	36%	1e-07	89.29%	29835	OY637518.1
84Select seq OY661705.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	69.4	69.4	34%	1e-07	90.57%	29872	OY661705.1
85Select seq OY653400.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	69.4	69.4	34%	1e-07	90.57%	29840	OY653400.1
86Select seq OY698221.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	67.6	67.6	33%	5e-07	90.38%	29846	OY698221.1
87Select seq OY678249.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	67.6	67.6	31%	5e-07	91.84%	29810	OY678249.1
88Select seq OY641521.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	67.6	67.6	31%	5e-07	91.84%	29875	OY641521.1
89Select seq OY625234.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	65.8	65.8	33%	2e-06	90.20%	29852	OY625234.1
90Select seq OY714119.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	65.8	65.8	23%	2e-06	100.00%	29868	OY714119.1
91Select seq OY711698.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	23%	6e-06	100.00%	29912	OY711698.1
92Select seq OY701687.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	23%	6e-06	100.00%	29838	OY701687.1
93Select seq OY714649.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	32%	6e-06	90.00%	29853	OY714649.1
94Select seq OY677887.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	23%	6e-06	100.00%	29844	OY677887.1
95Select seq OY695180.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	30%	6e-06	91.49%	29829	OY695180.1
96Select seq OY702651.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	23%	6e-06	100.00%	29839	OY702651.1
97Select seq OY681529.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	63.9	63.9	23%	6e-06	100.00%	29861	OY681529.1
98Select seq OY632882.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	62.1	62.1	22%	2e-05	100.00%	29429	OY632882.1
99Select seq OY677105.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	Severe acute respiratory syndrome coronavirus 2	NA	2697049	62.1	62.1	22%	2e-05	100.00%	29830	OY677105.1
100Select seq MW927522.1	Paenibacillus phage Pahemo, complete genome	Paenibacillus phage Pahemo	NA	2835998	62.1	122	33%	2e-05	88.00%	42027	MW927522.1

- hover to see the title
- click to show alignments
- Show Conserved Domains
- Alignment Scores
- < 40
- 40 - 50
- 50 - 80
- 80 - 200
- >= 200
- Help
  The graphic is an overview of the database sequences aligned to the query sequence. These are represented horizontal bars colored coded by score and showing the extent of the alignment on the query sequence. Separate aligned regions on the same database sequence are connected by a thin grey line. Mousing over an alignment shows the database sequence title. Clicking an alignment displays a box with more details about the alignment and link to the sequence alignment itself in the Alignments section of the report.
- 100 sequences selected
- Help
Distribution of the top 129 Blast Hits on 100 subject sequences

Query

1
30
60
90
120
150
- Alignment view
- CDS feature
- Line length:
- Help
  Alignment view: Choose how to view alignments. The default "pairwise" view shows how each subject sequence aligns individually to the query sequence. The "query-anchored" view shows how all subject sequences align to the query sequence. For each view type, you can choose to show "identities" (matching residues) as letters or dots. more...
  
  CDS feature: Show annotated coding region and translation. more...
  
  Line length: Number of letters to show on one line in an alignment.
- 100 sequences selected
- Help
Loading alignment... for sequences gi|2165835426,gi|2165836382,gi|2165834316,gi|2165834141,gi|1973745234 Reading indexes 1-5

Download GenBank Graphics
Sort by:
Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV196492.1Length: 30243Number of Matches: 2

Related Information

Range 1: 65 to 136GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

115 bits(62) 2e-21() 69/72(96%) 2/72(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAG--CTTATCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct 136 ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGTGCTTATCTCGTATGCCGTCTTCTG 77 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 76 CTTGAAAAAAAA 65

Range 2: 180 to 251GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #2
Score Expect Identities Gaps Strand Frame

115 bits(62) 2e-21() 69/72(96%) 2/72(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAG--CTTATCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| Sbjct 251 ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGTGCTTATCTCGTATGCCGTCTTCTG 192 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 191 CTTGAAAAAAAA 180

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV196890.1Length: 30101Number of Matches: 1

Related Information

Range 1: 44 to 115GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 68/72(94%) 2/72(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT--AGCTTATCTCGTATGCCGTCTTCTG 59 ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| Sbjct 115 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCACGTTATCTCGTATGCCGTCTTCTG 56 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 55 CTTGAAAAAAAA 44

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV196022.1Length: 30562Number of Matches: 1

Related Information

Range 1: 517 to 588GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 68/72(94%) 2/72(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGC-T-TATCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||| Sbjct 588 ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGCATACATCTCGTATGCCGTCTTCTG 529 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 528 CTTGAAAAAAAA 517

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV195847.1Length: 30308Number of Matches: 1

Related Information

Range 1: 46 to 117GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 68/72(94%) 2/72(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTA--TCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| Sbjct 117 ATCGGAAGAGCACACGTCTGAACTCCAGTCACCCGCTTAAATCTCGTATGCCGTCTTCTG 58 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 57 CTTGAAAAAAAA 46

Download GenBank Graphics
Sort by:
Next Previous Descriptions

Asarum satsumense chloroplast DNA, nearly complete sequence
Sequence ID: LC529901.1Length: 164607Number of Matches: 3

Related Information

Range 1: 164423 to 164494GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 68/72(94%) 2/72(2%) Plus/Plus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTA--GCTTATCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||||| || |||||||||||||||||||| Sbjct 164423 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAAGGCGAATCTCGTATGCCGTCTTCTG 164482 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 164483 CTTGAAAAAAAA 164494

Range 2: 117101 to 117169GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #2
Score Expect Identities Gaps Strand Frame

104 bits(56) 4e-18() 65/69(94%) 2/69(2%) Plus/Plus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTA--GCTTATCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||||| || |||||||||||||||||||| Sbjct 117101 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAAGGCGAATCTCGTATGCCGTCTTCTG 117160 Query 60 CTTGaaaaa 68 ||||||||| Sbjct 117161 CTTGAAAAA 117169

Range 3: 11719 to 11751GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #3
Score Expect Identities Gaps Strand Frame

62.1 bits(33) 2e-05() 33/33(100%) 0/33(0%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT 34 ||||||||||||||||||||||||||||||||| Sbjct 11751 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT 11719
Loading alignment... for sequences gi|2165834303,gi|2165835560,gi|2155043183,gi|2507497987,gi|2165834670 Reading indexes 6-10

Download GenBank Graphics
Sort by:
Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV196009.1Length: 30101Number of Matches: 2

Related Information

Range 1: 42 to 113GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 68/72(94%) 2/72(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT-AGCTT-ATCTCGTATGCCGTCTTCTG 59 ||||||||||||||||||||||||||||||||| | || |||||||||||||||||||| Sbjct 113 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGATTCATCTCGTATGCCGTCTTCTG 54 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 53 CTTGAAAAAAAA 42

Range 2: 29914 to 29985GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #2
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 68/72(94%) 2/72(2%) Plus/Plus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT-AGCTT-ATCTCGTATGCCGTCTTCTG 59 ||||||||||||||||||||||||||||||||| | || |||||||||||||||||||| Sbjct 29914 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGGATTCATCTCGTATGCCGTCTTCTG 29973 Query 60 CTTGaaaaaaaa 71 |||||||||||| Sbjct 29974 CTTGAAAAAAAA 29985

Download GenBank Graphics
Sort by:
Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV196626.1Length: 30095Number of Matches: 2

Related Information

Range 1: 148 to 219GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

110 bits(59) 8e-20() 69/73(95%) 4/73(5%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAG-CT-T-ATCTCGTATGCCGTCTTCT 58 |||||||||||||||||||||||||||||||| || || | ||||||||||||||||||| Sbjct 219 ATCGGAAGAGCACACGTCTGAACTCCAGTCAC-AGCCTATCATCTCGTATGCCGTCTTCT 161 Query 59 GCTTGaaaaaaaa 71 ||||||||||||| Sbjct 160 GCTTGAAAAAAAA 148

Range 2: 30020 to 30069GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #2
Score Expect Identities Gaps Strand Frame

69.4 bits(37) 1e-07() 47/51(92%) 4/51(7%) Plus/Plus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGC-T-T-ATCTCGTATG 49 |||||||||||||||||||||||||||||||| ||| | | |||||||||| Sbjct 30020 ATCGGAAGAGCACACGTCTGAACTCCAGTCAC-AGCCTATCATCTCGTATG 30069

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV015804.1Length: 29996Number of Matches: 1

Related Information

Range 1: 29872 to 29945GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

106 bits(57) 1e-18() 69/74(93%) 4/74(5%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT--A-GCTT-ATCTCGTATGCCGTCTTC 57 ||||||||||||||||||||||||||||||||| | | || |||||||||||||||||| Sbjct 29945 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCAAGGATTCATCTCGTATGCCGTCTTC 29886 Query 58 TGCTTGaaaaaaaa 71 |||||||||||||| Sbjct 29885 TGCTTGAAAAAAAA 29872

Download GenBank Graphics Next Previous Descriptions

Klebsiella phage phiKp_32 DNA, complete genome
Sequence ID: LC768500.1Length: 251460Number of Matches: 1

Related Information

Range 1: 1 to 70GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

106 bits(57) 1e-18() 66/70(94%) 2/70(2%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCAC--TAGCTTATCTCGTATGCCGTCTTCTG 59 |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| Sbjct 70 ATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGAGCCTATCTCGTATGCCGTCTTCTG 11 Query 60 CTTGaaaaaa 69 |||||||||| Sbjct 10 CTTGAAAAAA 1

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV196177.1Length: 30003Number of Matches: 1

Related Information

Range 1: 44 to 115GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

104 bits(56) 4e-18() 68/73(93%) 4/73(5%) Plus/Minus

Features:

Query 2 ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCT--T-ATCTCGTATGCCGTCTTCT 58 ||||||||||||||||||||||||||||||||| || | ||||||||||||||||||| Sbjct 115 ATCGGAAGAGCACACGTCTGAACTCCAGTCACT-CCTCATGATCTCGTATGCCGTCTTCT 57 Query 59 GCTTGaaaaaaaa 71 ||||||||||||| Sbjct 56 GCTTGAAAAAAAA 44

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
115 bits(62)	2e-21()	69/72(96%)	2/72(2%)	Plus/Minus

Alignment statistics for match #2
Score	Expect	Identities	Gaps	Strand	Frame
115 bits(62)	2e-21()	69/72(96%)	2/72(2%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	68/72(94%)	2/72(2%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	68/72(94%)	2/72(2%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	68/72(94%)	2/72(2%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	68/72(94%)	2/72(2%)	Plus/Plus

Alignment statistics for match #2
Score	Expect	Identities	Gaps	Strand	Frame
104 bits(56)	4e-18()	65/69(94%)	2/69(2%)	Plus/Plus

Alignment statistics for match #3
Score	Expect	Identities	Gaps	Strand	Frame
62.1 bits(33)	2e-05()	33/33(100%)	0/33(0%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	68/72(94%)	2/72(2%)	Plus/Minus

Alignment statistics for match #2
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	68/72(94%)	2/72(2%)	Plus/Plus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
110 bits(59)	8e-20()	69/73(95%)	4/73(5%)	Plus/Minus

Alignment statistics for match #2
Score	Expect	Identities	Gaps	Strand	Frame
69.4 bits(37)	1e-07()	47/51(92%)	4/51(7%)	Plus/Plus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
106 bits(57)	1e-18()	69/74(93%)	4/74(5%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
106 bits(57)	1e-18()	66/70(94%)	2/70(2%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
104 bits(56)	4e-18()	68/73(93%)	4/73(5%)	Plus/Minus

Taxonomy

100 sequences selected
Help

Lineage

Lineage Report
Organism	Blast Name	Score	Number of Hits	Description
root			102
.Viruses	viruses		83
..Riboviria	viruses		68
...Orthornavirae	viruses		67
....Severe acute respiratory syndrome coronavirus 2	viruses	115	66	Severe acute respiratory syndrome coronavirus 2 hits
....Diaporthe negative-stranded RNA virus 1	viruses	78.7	1	Diaporthe negative-stranded RNA virus 1 hits
...Diabrotica undecimpunctata virus 1	viruses	97.1	1	Diabrotica undecimpunctata virus 1 hits
..Klebsiella phage phiKp_32	viruses	106	1	Klebsiella phage phiKp_32 hits
..Bacillus phage vB_BthP-HD73phi	viruses	104	1	Bacillus phage vB_BthP-HD73phi hits
..macacine betaherpesvirus 3	viruses	104	1	macacine betaherpesvirus 3 hits
..human gammaherpesvirus 4	viruses	102	2	human gammaherpesvirus 4 hits
..Maldvirus fossil29388	viruses	102	1	Maldvirus fossil29388 hits
..Bacillus phage Whiting18	viruses	99.0	1	Bacillus phage Whiting18 hits
..Salmonella phage TS13	viruses	99.0	1	Salmonella phage TS13 hits
..Orf virus	viruses	97.1	1	Orf virus hits
..Caulobacter phage Ccr29	viruses	93.5	1	Caulobacter phage Ccr29 hits
..Staphylococcus phage Andhra	viruses	75.0	2	Staphylococcus phage Andhra hits
..Mycolicibacterium phage Kashi_SSH1	viruses	71.3	1	Mycolicibacterium phage Kashi_SSH1 hits
..Klebsiella pneumoniae phage	viruses	69.4	1	Klebsiella pneumoniae phage hits
..Paenibacillus phage Pahemo	viruses	62.1	1	Paenibacillus phage Pahemo hits
.Asarum satsumense	flowering plants	110	1	Asarum satsumense hits
.Klebsiella pneumoniae	enterobacteria	104	2	Klebsiella pneumoniae hits
.Escherichia coli	enterobacteria	104	1	Escherichia coli hits
.Enterococcus faecium	firmicutes	104	1	Enterococcus faecium hits
.Cecropia pachystachya	eudicots	104	1	Cecropia pachystachya hits
.Eimeria mitis	apicomplexans	102	1	Eimeria mitis hits
.Conus episcopatus	gastropods	99.0	1	Conus episcopatus hits
.Lasthenia californica	eudicots	99.0	1	Lasthenia californica hits
.Escherichia coli str. K-12 substr. MG1655	enterobacteria	99.0	1	Escherichia coli str. K-12 substr. MG1655 hits
.Yersinia enterocolitica	enterobacteria	95.3	1	Yersinia enterocolitica hits
.Fargesia denudata	monocots	91.6	2	Fargesia denudata hits
.Moina brachiata	crustaceans	87.9	1	Moina brachiata hits
.Helicobacter pylori	e-proteobacteria	87.9	1	Helicobacter pylori hits
.Nitrospira sp.	bacteria	86.1	1	Nitrospira sp. hits
.Gossypium raimondii	eudicots	82.4	1	Gossypium raimondii hits
.Cloning vector pFosill-2	other sequences	71.3	1	Cloning vector pFosill-2 hits
.Maricurvus nonylphenolicus	g-proteobacteria	71.3	1	Maricurvus nonylphenolicus hits

Organism

Organism Report
Description	Score	E value	Accession
Severe acute respiratory syndrome coronavirus 2 [viruses] Next Previous First
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	115	2e-21	OV196492
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	110	8e-20	OV196890
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	110	8e-20	OV196022
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	110	8e-20	OV195847
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	110	8e-20	OV196009
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	110	8e-20	OV196626
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	106	1e-18	OV015804
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV196177
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV196107
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV195202
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV195924
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV196275
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV196298
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV196026
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV197539
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV197136
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV195107
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV197189
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV197600
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV195597
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	104	4e-18	OV195277
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	100	5e-17	OV016108
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	100	5e-17	OV264044
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	100	5e-17	OV016109
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	99.0	2e-16	OV196099
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	99.0	2e-16	OV197187
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	99.0	2e-16	OV196000
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	99.0	2e-16	OV196488
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	99.0	2e-16	OV196584
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	95.3	2e-15	OV196467
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	93.5	8e-15	OV195900
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	93.5	8e-15	OV196273
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	1e-13	OV377758
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	84.2	5e-12	OV197487
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	82.4	2e-11	OY629453
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	82.4	2e-11	OY648812
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	80.5	6e-11	OY655439
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	80.5	6e-11	OY684664
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	78.7	2e-10	OY702104
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	75.0	3e-09	OY706291
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	73.1	1e-08	OY708460
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	73.1	1e-08	OY684713
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	73.1	1e-08	OY716713
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	73.1	1e-08	OY649758
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	73.1	1e-08	OY699857
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	71.3	4e-08	OY702345
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	69.4	1e-07	OY709493
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	69.4	1e-07	OY712147
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	69.4	1e-07	OY694677
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	69.4	1e-07	OY637518
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	69.4	1e-07	OY661705
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	69.4	1e-07	OY653400
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	67.6	5e-07	OY698221
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	67.6	5e-07	OY678249
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	67.6	5e-07	OY641521
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	65.8	2e-06	OY625234
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	65.8	2e-06	OY714119
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY711698
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY701687
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY714649
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY677887
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY695180
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY702651
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	63.9	6e-06	OY681529
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	62.1	2e-05	OY632882
Severe acute respiratory syndrome coronavirus 2 genome assembly, complete genome: monopartite	62.1	2e-05	OY677105
Asarum satsumense [flowering plants] Next Previous First
Asarum satsumense chloroplast DNA, nearly complete sequence	110	8e-20	LC529901
Klebsiella phage phiKp_32 [viruses] Next Previous First
Klebsiella phage phiKp_32 DNA, complete genome	106	1e-18	LC768500
Klebsiella pneumoniae [enterobacteria] Next Previous First
Klebsiella pneumoniae d1-42 plasmid pd1-42_D DNA, complete genome	104	4e-18	AP040921
Klebsiella pneumoniae e1-38 DNA, complete genome	104	4e-18	AP040949
Bacillus phage vB_BthP-HD73phi [viruses] Next Previous First
Bacillus phage vB_BthP-HD73phi, complete genome	104	4e-18	MK310228
Escherichia coli [enterobacteria] Next Previous First
Escherichia coli d1-73 DNA, complete genome	104	4e-18	AP040934
Enterococcus faecium [firmicutes] Next Previous First
Enterococcus faecium EV0426-12 plasmid pIHVA-EV0426-12 DNA, complete sequence	104	4e-18	LC566215
macacine betaherpesvirus 3 (Rhesus cytomegalovirus) [viruses] Next Previous First
Macacine betaherpesvirus 3 strain UCD59, complete genome	104	4e-18	MT157331
Cecropia pachystachya [eudicots] Next Previous First
Cecropia pachystachya isolate W55 18S small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S large subunit ribosomal RNA gene, partial sequence	104	4e-18	OM892756
human gammaherpesvirus 4 (Epstein-Barr virus) [viruses] Next Previous First
Human gammaherpesvirus 4 isolate Human herpesvirus 4 genome assembly, chromosome: I	102	1e-17	LS992247
Human gammaherpesvirus 4 isolate ebv14, partial genome	102	1e-17	MH883760
Eimeria mitis [apicomplexans] Next Previous First
Eimeria mitis uncharacterized protein (EMH_0029470), partial mRNA	102	1e-17	XM_013494305
Maldvirus fossil29388 [viruses] Next Previous First
MAG TPA_asm: Maldvirus fossil29388 isolate Mald29388 genomic sequence	102	1e-17	BK066886
Bacillus phage Whiting18 [viruses] Next Previous First
Bacillus phage Whiting18, complete genome	99.0	2e-16	MW477480
Conus episcopatus [gastropods] Next Previous First
Conus episcopatus mRNA, sequence id; Ep642-SF13	99.0	2e-16	AK443485
Lasthenia californica [eudicots] Next Previous First
Lasthenia californica chloroplast	99.0	2e-16	KY965816
Escherichia coli str. K-12 substr. MG1655 [enterobacteria] Next Previous First
Escherichia coli str. K-12 substr. MG1655 D41c DNA, complete genome	99.0	2e-16	AP027461
Salmonella phage TS13 [viruses] Next Previous First
Salmonella phage TS13, complete genome	99.0	2e-16	MK249308
Diabrotica undecimpunctata virus 1 [viruses] Next Previous First
MAG: Diabrotica undecimpunctata virus 1, complete genome	97.1	6e-16	MN646770
Orf virus [viruses] Next Previous First
Orf virus isolate FX10, partial genome	97.1	6e-16	PP943425
Yersinia enterocolitica [enterobacteria] Next Previous First
Yersinia enterocolitica strain Gp200 chromosome	95.3	2e-15	CP107088
Caulobacter phage Ccr29 [viruses] Next Previous First
Caulobacter phage Ccr29, complete genome	93.5	8e-15	KY555145
Fargesia denudata [monocots] Next Previous First
Fargesia denudata chloroplast, complete genome	91.6	3e-14	NC_034747
Fargesia denudata chloroplast, complete genome	91.6	3e-14	KX904877
Moina brachiata [crustaceans] Next Previous First
Moina brachiata genomic DNA containing mtDNA region, isolate DE-FRO-2-1	87.9	4e-13	LS991521
Helicobacter pylori [e-proteobacteria] Next Previous First
Helicobacter pylori strain Hpfe077 chromosome, complete genome	87.9	4e-13	CP094103
Nitrospira sp. [bacteria] Next Previous First
MAG: Nitrospira sp. AFB01 DNA, complete genome	86.1	1e-12	AP038805
Gossypium raimondii (Peruvian cotton) [eudicots] Next Previous First
Gossypium raimondii isolate Gr291 retrotransposon Ty3, complete sequence	82.4	2e-11	KT895861
Diaporthe negative-stranded RNA virus 1 [viruses] Next Previous First
Diaporthe negative-stranded RNA virus 1 isolate SO4 9A, complete genome	78.7	2e-10	OQ808567
Staphylococcus phage Andhra [viruses] Next Previous First
Staphylococcus phage Andhra, complete genome	75.0	3e-09	NC_047813
Staphylococcus phage Andhra, complete genome	75.0	3e-09	KY442063
Mycolicibacterium phage Kashi_SSH1 [viruses] Next Previous First
Mycolicibacterium phage Kashi_SSH1, complete genome	71.3	4e-08	ON551388
Cloning vector pFosill-2 [other sequences] Next Previous First
Cloning vector pFosill-2, complete sequence	71.3	4e-08	JX069762
Maricurvus nonylphenolicus [g-proteobacteria] Next Previous First
Maricurvus nonylphenolicus KU41E DNA, complete genome	71.3	4e-08	AP031498
Klebsiella pneumoniae phage [viruses] Next Previous First
Klebsiella pneumoniae phage strain 5899STDY8049230 genome assembly, chromosome: 1	69.4	1e-07	OU509537
Paenibacillus phage Pahemo [viruses] Next Previous First
Paenibacillus phage Pahemo, complete genome	62.1	2e-05	MW927522

Taxonomy

Taxonomy Report
Taxonomy	Number of hits	Number of Organisms	Description
root	102	33
. Viruses	83	16
.. Riboviria	68	3
... Orthornavirae	67	2
.... Severe acute respiratory syndrome coronavirus 2	66	1	Severe acute respiratory syndrome coronavirus 2 hits
.... Diaporthe negative-stranded RNA virus 1	1	1	Diaporthe negative-stranded RNA virus 1 hits
... Diabrotica undecimpunctata virus 1	1	1	Diabrotica undecimpunctata virus 1 hits
.. Heunggongvirae	11	9
... Caudoviricetes	8	7
.... Klebsiella phage phiKp_32	1	1	Klebsiella phage phiKp_32 hits
.... Caudoviricetes incertae sedis	7	6
..... Salasmaviridae	2	2
...... Bacillus phage vB_BthP-HD73phi	1	1	Bacillus phage vB_BthP-HD73phi hits
...... Bacillus phage Whiting18	1	1	Bacillus phage Whiting18 hits
..... Salmonella phage TS13	1	1	Salmonella phage TS13 hits
..... Caulobacter phage Ccr29	1	1	Caulobacter phage Ccr29 hits
..... Staphylococcus phage Andhra	2	1	Staphylococcus phage Andhra hits
..... Paenibacillus phage Pahemo	1	1	Paenibacillus phage Pahemo hits
... Orthoherpesviridae	3	2
.... macacine betaherpesvirus 3	1	1	macacine betaherpesvirus 3 hits
.... human gammaherpesvirus 4	2	1	human gammaherpesvirus 4 hits
.. Maldvirus fossil29388	1	1	Maldvirus fossil29388 hits
.. Orf virus	1	1	Orf virus hits
.. unclassified bacterial viruses	2	2
... Mycolicibacterium phage Kashi_SSH1	1	1	Mycolicibacterium phage Kashi_SSH1 hits
... Klebsiella pneumoniae phage	1	1	Klebsiella pneumoniae phage hits
. cellular organisms	18	16
.. Eukaryota	9	8
... Mesangiospermae	6	5
.... Asarum satsumense	1	1	Asarum satsumense hits
.... Pentapetalae	3	3
..... rosids	2	2
...... Cecropia pachystachya	1	1	Cecropia pachystachya hits
...... Gossypium raimondii	1	1	Gossypium raimondii hits
..... Lasthenia californica	1	1	Lasthenia californica hits
.... Fargesia denudata	2	1	Fargesia denudata hits
... Eimeria mitis	1	1	Eimeria mitis hits
... Protostomia	2	2
.... Conus episcopatus	1	1	Conus episcopatus hits
.... Moina brachiata	1	1	Moina brachiata hits
.. Bacteria	9	8
... Pseudomonadati	8	7
.... Gammaproteobacteria	6	5
..... Enterobacterales	5	4
...... Enterobacteriaceae	4	3
....... Klebsiella pneumoniae	2	1	Klebsiella pneumoniae hits
....... Escherichia	2	2
........ Escherichia coli	1	2	Escherichia coli hits
......... Escherichia coli str. K-12 substr. MG1655	1	1	Escherichia coli str. K-12 substr. MG1655 hits
...... Yersinia enterocolitica	1	1	Yersinia enterocolitica hits
..... Maricurvus nonylphenolicus	1	1	Maricurvus nonylphenolicus hits
.... Helicobacter pylori	1	1	Helicobacter pylori hits
.... Nitrospira sp.	1	1	Nitrospira sp. hits
... Enterococcus faecium	1	1	Enterococcus faecium hits
. Cloning vector pFosill-2	1	1	Cloning vector pFosill-2 hits

Filter Results

Sequences producing significant alignments