(cache)NCBI Blast:emb|LR994533.1|

Save Search

Search Parameters
Search parameter name	Search parameter value
Program	blastn
Word size	28
Expect value	0.05
Hitlist size	100
Match/Mismatch scores	1,-2
Gapcosts	0,2.5
Low Complexity Filter	Yes
Filter string	L;m;
Genetic Code	1

Database
Database parameter name	Database parameter value
Posted date	Feb 19, 2025 7:30 PM
Number of letters	237,266,810,741
Number of sequences	7,972,147
Entrez query	Includes: Sarbecovirus (taxid:2509511) Excludes: None

Karlin-Altschul statistics
Params	Ungapped	Gapped
Lambda	1.33271	1.28
K	0.620991	0.46
H	1.12409	0.85

Results Statistics
Results Statistics parameter name	Results Statistics parameter value
Length adjustment	41
Effective length of query	162886
Effective length of database	236939952714
Effective search space	38594201137772604
Effective search space used	38594201137772604

Your search is limited to records that include: Sarbecovirus (taxid:2509511)

Job Title

emb|LR994533.1| ...

RID

VPASSM1D013 Search expires on 02-24 21:05 pm

Download All

Results for

Program

BLASTN

Citation

Database

See details

Title:Nucleotide collection (nt)
Description:The nucleotide collection consists of GenBank+EMBL+DDBJ+PDB+RefSeq sequences, but excludes EST, STS, GSS, WGS, TSA, patent sequences as well as phase 0, 1, and 2 HTGS sequences and sequences longer than 100Mb. The database is non-redundant. Identical sequences have been merged into one entry, while preserving the accession, GI, title and taxonomy information for each entry.
Molecule Type:mixed DNA
Update date:2025/02/22
Number of sequences:112591598

Query ID

LR994533.1

Description

Human gammaherpesvirus 4 genome assembly, plasmid: 1 ...

Molecule type

nucleic acid

Query Length

162927

Other reports

Distance tree of results MSA viewer

Filter Results

Descriptions

select all
16 sequences selected

, Reading indexes 1-5, displaying indexes 1-5

Sequences producing significant alignments:
Select for downloading or viewing reports	Description	Scientific Name	Common Name	Taxid	Max Score	Total Score	Query Cover	E value	Per. Ident	Acc. Len	Accession
1Select seq OV197487.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	100	100	0%	2e-14	95.31%	30104	OV197487.1
2Select seq OV195202.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	95.3	190	0%	8e-13	93.65%	30221	OV195202.1
3Select seq OV195277.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	95.3	95.3	0%	8e-13	93.65%	30090	OV195277.1
4Select seq OV016109.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	91.6	91.6	0%	1e-11	92.42%	30090	OV016109.1
5Select seq OV197600.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	89.8	0%	4e-11	92.06%	30105	OV197600.1
6Select seq OV197189.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	89.8	0%	4e-11	92.06%	30094	OV197189.1
7Select seq OV196499.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	89.8	0%	4e-11	92.19%	30525	OV196499.1
8Select seq OV196298.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	89.8	0%	4e-11	92.19%	30559	OV196298.1
9Select seq OV195924.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	175	0%	4e-11	92.06%	30333	OV195924.1
10Select seq OV195900.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	89.8	89.8	0%	4e-11	92.06%	30109	OV195900.1
11Select seq OV377772.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	86.1	86.1	0%	5e-10	90.77%	30383	OV377772.1
12Select seq OV197539.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	84.2	84.2	0%	2e-09	90.62%	30057	OV197539.1
13Select seq OV196488.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	84.2	84.2	0%	2e-09	90.48%	30094	OV196488.1
14Select seq OV196275.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	84.2	168	0%	2e-09	90.48%	30423	OV196275.1
15Select seq OV197136.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	78.7	78.7	0%	8e-08	89.23%	30102	OV197136.1
16Select seq OV197187.1	Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	Severe acute respiratory syndrome coronavirus 2	NA	2697049	65.8	65.8	0%	6e-04	90.20%	30208	OV197187.1

- hover to see the title
- click to show alignments
- Show Conserved Domains
- Alignment Scores
- < 40
- 40 - 50
- 50 - 80
- 80 - 200
- >= 200
- Help
  The graphic is an overview of the database sequences aligned to the query sequence. These are represented horizontal bars colored coded by score and showing the extent of the alignment on the query sequence. Separate aligned regions on the same database sequence are connected by a thin grey line. Mousing over an alignment shows the database sequence title. Clicking an alignment displays a box with more details about the alignment and link to the sequence alignment itself in the Alignments section of the report.
- 16 sequences selected
- Help
Distribution of the top 19 Blast Hits on 16 subject sequences

Query

1
30000
60000
90000
120000
150000
- Alignment view
- CDS feature
- Line length:
- Help
  Alignment view: Choose how to view alignments. The default "pairwise" view shows how each subject sequence aligns individually to the query sequence. The "query-anchored" view shows how all subject sequences align to the query sequence. For each view type, you can choose to show "identities" (matching residues) as letters or dots. more...
  
  CDS feature: Show annotated coding region and translation. more...
  
  Line length: Number of letters to show on one line in an alignment.
- 16 sequences selected
- Help
Loading alignment... for sequences gi|2165837593,gi|2165832904,gi|2165832678,gi|2155043488,gi|2165837707 Reading indexes 1-5

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV197487.1Length: 30104Number of Matches: 1

Related Information

Range 1: 40 to 102GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

100 bits(54) 2e-14() 61/64(95%) 2/64(3%) Plus/Minus

Features:

Query 103744 GTCGTGTAGGGAAAGAGTGTAGGCT-ATAGTGTAGATCTCGGTGGTCGCCGTATCATTAA 103802 |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| Sbjct 102 GTCGTGTAGGGAAAGAGTGTAG-CTCCTAGTGTAGATCTCGGTGGTCGCCGTATCATTAA 44 Query 103803 AAAA 103806 |||| Sbjct 43 AAAA 40

Download GenBank Graphics
Sort by:
Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV195202.1Length: 30221Number of Matches: 2

Related Information

Range 1: 85 to 147GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

95.3 bits(51) 8e-13() 59/63(94%) 0/63(0%) Plus/Minus

Features:

Query 103744 GTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 103803 ||||||||||||||||||||| || | |||||||||||||||||||||||||||||||| Sbjct 147 GTCGTGTAGGGAAAGAGTGTAAGCACTGGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 88 Query 103804 AAA 103806 ||| Sbjct 87 AAA 85

Range 2: 30045 to 30107GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #2
Score Expect Identities Gaps Strand Frame

95.3 bits(51) 8e-13() 59/63(94%) 0/63(0%) Plus/Plus

Features:

Query 103744 GTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 103803 ||||||||||||||||||||| || | |||||||||||||||||||||||||||||||| Sbjct 30045 GTCGTGTAGGGAAAGAGTGTAAGCACTGGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 30104 Query 103804 AAA 103806 ||| Sbjct 30105 AAA 30107

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV195277.1Length: 30090Number of Matches: 1

Related Information

Range 1: 29942 to 30004GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

95.3 bits(51) 8e-13() 59/63(94%) 0/63(0%) Plus/Plus

Features:

Query 103744 GTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 103803 ||||||||||||||||||||| | | | |||||||||||||||||||||||||||||||| Sbjct 29942 GTCGTGTAGGGAAAGAGTGTACGGTCTTGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 30001 Query 103804 AAA 103806 ||| Sbjct 30002 AAA 30004

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV016109.1Length: 30090Number of Matches: 1

Related Information

Range 1: 30004 to 30068GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

91.6 bits(49) 1e-11() 61/66(92%) 4/66(6%) Plus/Plus

Features:

Query 103744 GTCGTGTAGGGAAAGAGTGTAGGCTA-T-A-GTGTAGATCTCGGTGGTCGCCGTATCATT 103800 |||||||||||||||||||| | ||| | | ||||||||||||||||||||||||||||| Sbjct 30004 GTCGTGTAGGGAAAGAGTGT-GCCTACTGAGGTGTAGATCTCGGTGGTCGCCGTATCATT 30062 Query 103801 AAAAAA 103806 |||||| Sbjct 30063 AAAAAA 30068

Download GenBank Graphics Next Previous Descriptions

Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1
Sequence ID: OV197600.1Length: 30105Number of Matches: 1

Related Information

Range 1: 29929 to 29991GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

89.8 bits(48) 4e-11() 58/63(92%) 0/63(0%) Plus/Plus

Features:

Query 103744 GTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 103803 |||||||||||||||||||| || | |||||||||||||||||||||||||||||||| Sbjct 29929 GTCGTGTAGGGAAAGAGTGTTGGAGTTGGTGTAGATCTCGGTGGTCGCCGTATCATTAAA 29988 Query 103804 AAA 103806 ||| Sbjct 29989 AAA 29991

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
100 bits(54)	2e-14()	61/64(95%)	2/64(3%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
95.3 bits(51)	8e-13()	59/63(94%)	0/63(0%)	Plus/Minus

Alignment statistics for match #2
Score	Expect	Identities	Gaps	Strand	Frame
95.3 bits(51)	8e-13()	59/63(94%)	0/63(0%)	Plus/Plus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
95.3 bits(51)	8e-13()	59/63(94%)	0/63(0%)	Plus/Plus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
91.6 bits(49)	1e-11()	61/66(92%)	4/66(6%)	Plus/Plus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
89.8 bits(48)	4e-11()	58/63(92%)	0/63(0%)	Plus/Plus

Taxonomy

16 sequences selected
Help

Lineage

Lineage Report
Organism	Blast Name	Score	Number of Hits	Description
Severe acute respiratory syndrome coronavirus 2	viruses	100	16	Severe acute respiratory syndrome coronavirus 2 hits

Organism

Organism Report
Description	Score	E value	Accession
Severe acute respiratory syndrome coronavirus 2 [viruses] Next Previous First
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	100	2e-14	OV197487
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	95.3	8e-13	OV195202
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	95.3	8e-13	OV195277
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	91.6	1e-11	OV016109
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	4e-11	OV197600
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	4e-11	OV197189
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	4e-11	OV196499
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	4e-11	OV196298
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	4e-11	OV195924
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	89.8	4e-11	OV195900
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	86.1	5e-10	OV377772
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	84.2	2e-09	OV197539
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	84.2	2e-09	OV196488
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	84.2	2e-09	OV196275
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	78.7	8e-08	OV197136
Severe acute respiratory syndrome coronavirus 2 genome assembly, chromosome: 1	65.8	6e-04	OV197187

Taxonomy

Taxonomy Report
Taxonomy	Number of hits	Number of Organisms	Description
Severe acute respiratory syndrome coronavirus 2	16	1	Severe acute respiratory syndrome coronavirus 2 hits

Filter Results

Sequences producing significant alignments