(cache)NCBI Blast:ref|NZ_JALJSU010000077.1|

Save Search

Search Parameters
Search parameter name	Search parameter value
Program	blastn
Word size	28
Expect value	0.05
Hitlist size	100
Match/Mismatch scores	1,-2
Gapcosts	0,2.5
Low Complexity Filter	Yes
Filter string	L;m;
Genetic Code	1

Database
Database parameter name	Database parameter value
Posted date	Feb 5, 2025 4:31 AM
Number of letters	2,689,577,477,565
Number of sequences	112,279,131
Entrez query	Includes: Excludes: None

Karlin-Altschul statistics
Params	Ungapped	Gapped
Lambda	1.33271	1.28
K	0.620991	0.46
H	1.12409	0.85

Results Statistics
Results Statistics parameter name	Results Statistics parameter value
Length adjustment	38
Effective length of query	719
Effective length of database	2685310870587
Effective search space	1930738515952053
Effective search space used	1930738515952053

Job Title

ref|NZ_JALJSU010000077.1| ...

RID

U9XR1C3V013 Search expires on 02-08 00:52 am

Download All

Results for

Program

BLASTN

Citation

Database

See details

Title:Nucleotide collection (nt)
Description:The nucleotide collection consists of GenBank+EMBL+DDBJ+PDB+RefSeq sequences, but excludes EST, STS, GSS, WGS, TSA, patent sequences as well as phase 0, 1, and 2 HTGS sequences and sequences longer than 100Mb. The database is non-redundant. Identical sequences have been merged into one entry, while preserving the accession, GI, title and taxonomy information for each entry.
Molecule Type:mixed DNA
Update date:2025/02/05
Number of sequences:112275153

Query ID

NZ_JALJSU010000077.1

Description

Escherichia coli strain SE51T NODE_84_length_757_cov_109.005882, whole genome shotgun sequence ...

Molecule type

dna

Query Length

757

Other reports

Distance tree of results MSA viewer

Filter Results

Descriptions

select all
29 sequences selected

, Reading indexes 1-5, displaying indexes 1-5

Sequences producing significant alignments:
Select for downloading or viewing reports	Description	Scientific Name	Common Name	Taxid	Max Score	Total Score	Query Cover	E value	Per. Ident	Acc. Len	Accession
1Select seq MT462569.1	Homo sapiens isolate CV47 anti-SARS-CoV-2 immunoglobulin kappa light chain variable region mRNA, partial cds	Homo sapiens	human	9606	104	104	20%	7e-17	78.85%	321	MT462569.1
2Select seq MF289025.1	Homo sapiens clone 315-02-1A05K immunoglobulin kappa chain variable region mRNA, partial cds	Homo sapiens	human	9606	84.2	84.2	20%	9e-11	77.12%	324	MF289025.1
3Select seq HQ644137.1	Mammalian expression vector pCK146, complete sequence	Mammalian expression vector pCK146	NA	943932	84.2	84.2	6%	9e-11	97.92%	5213	HQ644137.1
4Select seq HQ644135.1	Mammalian expression vector pCK65, complete sequence	Mammalian expression vector pCK65	NA	943931	84.2	84.2	6%	9e-11	97.92%	4828	HQ644135.1
5Select seq MG916977.1	Nothocricetulus migratorius immunoglobulin light chain variable region mRNA, partial cds	Nothocricetulus migratorius	Armenian hamster	3122392	76.8	76.8	6%	1e-08	95.74%	402	MG916977.1
6Select seq OK315333.1	Synthetic construct E2-R2-PIFN gene, complete cds	synthetic construct	NA	32630	76.8	76.8	6%	1e-08	95.74%	1542	OK315333.1
7Select seq MN278637.1	Homo sapiens IGL c2197_light_IGKV1-39_IGKJ1 mRNA, partial cds	Homo sapiens	human	9606	73.1	73.1	11%	2e-07	82.93%	361	MN278637.1
8Select seq MN277617.1	Homo sapiens IGL c1177_light_IGKV1-39_IGKJ1 mRNA, partial cds	Homo sapiens	human	9606	73.1	73.1	11%	2e-07	82.93%	361	MN277617.1
9Select seq XM_062388653.1	PREDICTED: Platichthys flesus H/ACA ribonucleoprotein complex non-core subunit NAF1-like (LOC133954293), mRNA	Platichthys flesus	European flounder	8260	60.2	60.2	5%	0.001	97.22%	2663	XM_062388653.1
10Select seq OX438720.1	Platichthys flesus genome assembly, chromosome: 5	Platichthys flesus	European flounder	8260	60.2	60.2	5%	0.001	97.22%	28543025	OX438720.1
11Select seq OZ209189.1	Poromitra crassiceps genome assembly, chromosome: 8B	Poromitra crassiceps	crested bigscale	88708	58.4	171	4%	0.005	100.00%	34801784	OZ209189.1
12Select seq OZ177862.1	Merluccius merluccius genome assembly, chromosome: 18	Merluccius merluccius	European hake	8063	58.4	58.4	4%	0.005	100.00%	25056228	OZ177862.1
13Select seq XM_066570127.1	PREDICTED: Molothrus aeneus protein phosphatase 1 regulatory subunit 13 like (PPP1R13L), mRNA	Molothrus aeneus	bronzed cowbird	84833	58.4	58.4	4%	0.005	100.00%	2570	XM_066570127.1
14Select seq OY829667.1	Echiichthys vipera genome assembly, chromosome: 22	Echiichthys vipera	lesser weever	94984	58.4	116	4%	0.005	100.00%	23679235	OY829667.1
15Select seq OY735298.1	Sprattus sprattus genome assembly, chromosome: 14	Sprattus sprattus	European sprat	196075	58.4	116	4%	0.005	100.00%	33177674	OY735298.1
16Select seq OX578254.1	Electrona antarctica genome assembly, chromosome: 9	Electrona antarctica	NA	206093	58.4	173	4%	0.005	100.00%	58470777	OX578254.1
17Select seq XM_053470261.1	PREDICTED: Spea bombifrons bassoon presynaptic cytomatrix protein (BSN), mRNA	Spea bombifrons	plains spadefoot toad	233779	58.4	175	4%	0.005	100.00%	12753	XM_053470261.1
18Select seq CP084618.1	Chlorella sorokiniana strain SLA-04 chromosome 13	Chlorella sorokiniana	NA	3076	58.4	58.4	4%	0.005	100.00%	1206010	CP084618.1
19Select seq OZ209219.1	Poromitra crassiceps genome assembly, chromosome: 8	Poromitra crassiceps	crested bigscale	88708	56.5	169	4%	0.019	100.00%	59984626	OZ209219.1
20Select seq OZ077150.1	Protomyctophum parallelum genome assembly, chromosome: 8	Protomyctophum parallelum	parallel lanternfish	1091426	56.5	56.5	4%	0.019	100.00%	54348578	OZ077150.1
21Select seq OZ001267.1	Protomyctophum bolini genome assembly, chromosome: 2	Protomyctophum bolini	NA	443714	56.5	56.5	4%	0.019	100.00%	53013336	OZ001267.1
22Select seq XM_056422989.1	PREDICTED: Pseudoliparis swirei nuclear receptor coactivator 3-like (LOC130199471), transcript variant X3, mRNA	Pseudoliparis swirei	NA	2059687	56.5	56.5	4%	0.019	100.00%	8355	XM_056422989.1
23Select seq XM_056422988.1	PREDICTED: Pseudoliparis swirei nuclear receptor coactivator 3-like (LOC130199471), transcript variant X2, mRNA	Pseudoliparis swirei	NA	2059687	56.5	56.5	4%	0.019	100.00%	8413	XM_056422988.1
24Select seq XM_056422987.1	PREDICTED: Pseudoliparis swirei nuclear receptor coactivator 3-like (LOC130199471), transcript variant X1, mRNA	Pseudoliparis swirei	NA	2059687	56.5	56.5	4%	0.019	100.00%	8514	XM_056422987.1
25Select seq XM_013392216.1	Eimeria acervulina hypothetical protein partial mRNA	Eimeria acervulina	NA	5801	56.5	113	4%	0.019	100.00%	665	XM_013392216.1
26Select seq CP064807.1	Epichloe typhina subsp. clarkii strain 1605_22 chromosome 4	Epichloe typhina subsp. clarkii	NA	1616224	56.5	56.5	4%	0.019	100.00%	7512497	CP064807.1
27Select seq OU342721.1	Taurulus bubalis genome assembly, chromosome: 11	Taurulus bubalis	NA	61643	56.5	56.5	4%	0.019	100.00%	28346675	OU342721.1
28Select seq XM_037287601.1	Zygotorulaspora mrakii transcription factor MCM1 (HG535_0C01170), partial mRNA	Zygotorulaspora mrakii	NA	42260	56.5	56.5	4%	0.019	100.00%	783	XM_037287601.1
29Select seq CP058606.1	Zygotorulaspora mrakii strain NRRL Y-6702 chromosome 3	Zygotorulaspora mrakii	NA	42260	56.5	56.5	4%	0.019	100.00%	1318115	CP058606.1

- hover to see the title
- click to show alignments
- Show Conserved Domains
- Alignment Scores
- < 40
- 40 - 50
- 50 - 80
- 80 - 200
- >= 200
- Help
  The graphic is an overview of the database sequences aligned to the query sequence. These are represented horizontal bars colored coded by score and showing the extent of the alignment on the query sequence. Separate aligned regions on the same database sequence are connected by a thin grey line. Mousing over an alignment shows the database sequence title. Clicking an alignment displays a box with more details about the alignment and link to the sequence alignment itself in the Alignments section of the report.
- 29 sequences selected
- Help
Distribution of the top 40 Blast Hits on 29 subject sequences

Query

1
150
300
450
600
750
- Alignment view
- CDS feature
- Line length:
- Help
  Alignment view: Choose how to view alignments. The default "pairwise" view shows how each subject sequence aligns individually to the query sequence. The "query-anchored" view shows how all subject sequences align to the query sequence. For each view type, you can choose to show "identities" (matching residues) as letters or dots. more...
  
  CDS feature: Show annotated coding region and translation. more...
  
  Line length: Number of letters to show on one line in an alignment.
- 29 sequences selected
- Help
Loading alignment... for sequences gi|1842744635,gi|1229405054,gi|317185366,gi|317185363,gi|1435072409 Reading indexes 1-5

Download GenBank Graphics Next Previous Descriptions

Homo sapiens isolate CV47 anti-SARS-CoV-2 immunoglobulin kappa light chain variable region mRNA, partial cds
Sequence ID: MT462569.1Length: 321Number of Matches: 1

Related Information

Range 1: 1 to 155GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

104 bits(56) 7e-17() 123/156(79%) 2/156(1%) Plus/Minus

Features:

Query 516 CTAGCGGCGTAGATCAGCAGCTTGGGGGCTTTACCAGGCTTCTGCTGATACCATGCCAGG 575 ||||| ||||| ||||| | || ||||||||||||||||||||||||||||| ||| Sbjct 155 CTAGCTGCGTAAATCAGTCGTTTAGGGGCTTTACCAGGCTTCTGCTGATACCAACCCAAA 96 Query 576 TAGTTTCGAATCCCCTGACTAGCGCGGCATGTGATGGTGACTCTGTCTCCCACGCTAGCG 635 | |||| ||||||||| || | ||| |||||||| || |||||||| ||||| || Sbjct 95 TCATTTCTAATCCCCTGGGAGGCCCTGCACGTGATGGTTACCCTGTCTCCTACGCTTGCT 36 Query 636 GACAG-TGAGGAAGGGCTCTGAGTCATCTGAATGTC 670 || || | || || ||||| |||||||||||||| Sbjct 35 GAGAGACTA-GATGGACTCTGCGTCATCTGAATGTC 1

Download GenBank Graphics Next Previous Descriptions

Homo sapiens clone 315-02-1A05K immunoglobulin kappa chain variable region mRNA, partial cds
Sequence ID: MF289025.1Length: 324Number of Matches: 1

Related Information

Range 1: 93 to 242GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

84.2 bits(45) 9e-11() 118/153(77%) 6/153(3%) Plus/Minus

Features:

Query 432 GGCTGCAGGCTGGAAATGGTCAGAGTAAAGTC-AGTCCCTGATCCACTGCCAGAGAAGCG 490 |||| ||| ||| ||||||||| || ||||| || ||||| ||||||||||||||||| Sbjct 242 GGCTCCAGTCTGCTAATGGTCAGGGTGAAGTCTCGT-CCTGACCCACTGCCAGAGAAGCG 184 Query 491 ACTTGGCACGCCAGACTG-CAGTGTGCTAGCGGCGTAGATCAGCAGCTTG-GGGGCTTTA 548 || | ||||| | | |||| || ||||||||||||| | | || || | Sbjct 183 GTCAGGAATGCCAG-TAGCCCTTGTGGAGGCTCCGTAGATCAGCAG-TCGAGGTGCCTGT 126 Query 549 CCAGGCTTCTGCTGATACCATGCCAGGTAGTTT 581 || |||||||||||||||||||||||||||||| Sbjct 125 CCTGGCTTCTGCTGATACCATGCCAGGTAGTTT 93

Download GenBank Graphics Next Previous Descriptions

Mammalian expression vector pCK146, complete sequence
Sequence ID: HQ644137.1Length: 5213Number of Matches: 1

Related Information

Range 1: 921 to 968GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

84.2 bits(45) 9e-11() 47/48(98%) 0/48(0%) Plus/Minus

Features:

Query 684 GGCACCCACAGCAGCAGCACCCACAGCAGCAGTGTATCGGTCTCCATG 731 ||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 968 GGCACCCACAGGAGCAGCACCCACAGCAGCAGTGTATCGGTCTCCATG 921

Download GenBank Graphics Next Previous Descriptions

Mammalian expression vector pCK65, complete sequence
Sequence ID: HQ644135.1Length: 4828Number of Matches: 1

Related Information

Range 1: 536 to 583GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

84.2 bits(45) 9e-11() 47/48(98%) 0/48(0%) Plus/Minus

Features:

Query 684 GGCACCCACAGCAGCAGCACCCACAGCAGCAGTGTATCGGTCTCCATG 731 ||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 583 GGCACCCACAGGAGCAGCACCCACAGCAGCAGTGTATCGGTCTCCATG 536

Download GenBank Graphics Next Previous Descriptions

Nothocricetulus migratorius immunoglobulin light chain variable region mRNA, partial cds
Sequence ID: MG916977.1Length: 402Number of Matches: 1

Related Information

Range 1: 1 to 47GenBank Graphics Next Match Previous Match First Match

Alignment statistics for match #1
Score Expect Identities Gaps Strand Frame

76.8 bits(41) 1e-08() 45/47(96%) 0/47(0%) Plus/Minus

Features:

Query 684 GGCACCCACAGCAGCAGCACCCACAGCAGCAGTGTATCGGTCTCCAT 730 |||||||||||||||||||||||||||||||| || ||||||||||| Sbjct 47 GGCACCCACAGCAGCAGCACCCACAGCAGCAGGGTGTCGGTCTCCAT 1

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
104 bits(56)	7e-17()	123/156(79%)	2/156(1%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
84.2 bits(45)	9e-11()	118/153(77%)	6/153(3%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
84.2 bits(45)	9e-11()	47/48(98%)	0/48(0%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
84.2 bits(45)	9e-11()	47/48(98%)	0/48(0%)	Plus/Minus

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
76.8 bits(41)	1e-08()	45/47(96%)	0/47(0%)	Plus/Minus

Taxonomy

29 sequences selected
Help

Lineage

Lineage Report
Organism	Blast Name	Score	Number of Hits	Description
root			29
.Eukaryota	eukaryotes		26
..Opisthokonta	eukaryotes		24
...Euteleostomi	vertebrates		21
....Tetrapoda	vertebrates		7
.....Amniota	vertebrates		6
......Euarchontoglires	placentals		5
.......Homo sapiens	primates	104	4	Homo sapiens hits
.......Nothocricetulus migratorius	rodents	76.8	1	Nothocricetulus migratorius hits
......Molothrus aeneus	birds	58.4	1	Molothrus aeneus hits
.....Spea bombifrons	frogs & toads	58.4	1	Spea bombifrons hits
....Platichthys flesus	bony fishes	60.2	2	Platichthys flesus hits
....Poromitra crassiceps	bony fishes	58.4	2	Poromitra crassiceps hits
....Merluccius merluccius	bony fishes	58.4	1	Merluccius merluccius hits
....Echiichthys vipera	bony fishes	58.4	1	Echiichthys vipera hits
....Sprattus sprattus	bony fishes	58.4	1	Sprattus sprattus hits
....Electrona antarctica	bony fishes	58.4	1	Electrona antarctica hits
....Protomyctophum parallelum	bony fishes	56.5	1	Protomyctophum parallelum hits
....Protomyctophum bolini	bony fishes	56.5	1	Protomyctophum bolini hits
....Pseudoliparis swirei	bony fishes	56.5	3	Pseudoliparis swirei hits
....Taurulus bubalis	bony fishes	56.5	1	Taurulus bubalis hits
...Epichloe typhina subsp. clarkii	ascomycete fungi	56.5	1	Epichloe typhina subsp. clarkii hits
...Zygotorulaspora mrakii	budding yeasts & others	56.5	2	Zygotorulaspora mrakii hits
..Chlorella sorokiniana	green algae	58.4	1	Chlorella sorokiniana hits
..Eimeria acervulina	apicomplexans	56.5	1	Eimeria acervulina hits
.Mammalian expression vector pCK146	other sequences	84.2	1	Mammalian expression vector pCK146 hits
.Mammalian expression vector pCK65	other sequences	84.2	1	Mammalian expression vector pCK65 hits
.synthetic construct	other sequences	76.8	1	synthetic construct hits

Organism

Organism Report
Description	Score	E value	Accession
Homo sapiens (human) [primates] Next Previous First
Homo sapiens isolate CV47 anti-SARS-CoV-2 immunoglobulin kappa light chain variable region mRNA, partial cds	104	7e-17	MT462569
Homo sapiens clone 315-02-1A05K immunoglobulin kappa chain variable region mRNA, partial cds	84.2	9e-11	MF289025
Homo sapiens IGL c2197_light_IGKV1-39_IGKJ1 mRNA, partial cds	73.1	2e-07	MN278637
Homo sapiens IGL c1177_light_IGKV1-39_IGKJ1 mRNA, partial cds	73.1	2e-07	MN277617
Mammalian expression vector pCK146 [other sequences] Next Previous First
Mammalian expression vector pCK146, complete sequence	84.2	9e-11	HQ644137
Mammalian expression vector pCK65 [other sequences] Next Previous First
Mammalian expression vector pCK65, complete sequence	84.2	9e-11	HQ644135
Nothocricetulus migratorius (Armenian hamster) [rodents] Next Previous First
Nothocricetulus migratorius immunoglobulin light chain variable region mRNA, partial cds	76.8	1e-08	MG916977
synthetic construct [other sequences] Next Previous First
Synthetic construct E2-R2-PIFN gene, complete cds	76.8	1e-08	OK315333
Platichthys flesus (European flounder) [bony fishes] Next Previous First
PREDICTED: Platichthys flesus H/ACA ribonucleoprotein complex non-core subunit NAF1-like (LOC133954293), mRNA	60.2	0.001	XM_062388653
Platichthys flesus genome assembly, chromosome: 5	60.2	0.001	OX438720
Poromitra crassiceps (crested bigscale) [bony fishes] Next Previous First
Poromitra crassiceps genome assembly, chromosome: 8B	58.4	0.005	OZ209189
Poromitra crassiceps genome assembly, chromosome: 8	56.5	0.019	OZ209219
Merluccius merluccius (European hake) [bony fishes] Next Previous First
Merluccius merluccius genome assembly, chromosome: 18	58.4	0.005	OZ177862
Molothrus aeneus (bronzed cowbird) [birds] Next Previous First
PREDICTED: Molothrus aeneus protein phosphatase 1 regulatory subunit 13 like (PPP1R13L), mRNA	58.4	0.005	XM_066570127
Echiichthys vipera (lesser weever) [bony fishes] Next Previous First
Echiichthys vipera genome assembly, chromosome: 22	58.4	0.005	OY829667
Sprattus sprattus (European sprat) [bony fishes] Next Previous First
Sprattus sprattus genome assembly, chromosome: 14	58.4	0.005	OY735298
Electrona antarctica [bony fishes] Next Previous First
Electrona antarctica genome assembly, chromosome: 9	58.4	0.005	OX578254
Spea bombifrons (plains spadefoot toad) [frogs & toads] Next Previous First
PREDICTED: Spea bombifrons bassoon presynaptic cytomatrix protein (BSN), mRNA	58.4	0.005	XM_053470261
Chlorella sorokiniana [green algae] Next Previous First
Chlorella sorokiniana strain SLA-04 chromosome 13	58.4	0.005	CP084618
Protomyctophum parallelum (parallel lanternfish) [bony fishes] Next Previous First
Protomyctophum parallelum genome assembly, chromosome: 8	56.5	0.019	OZ077150
Protomyctophum bolini [bony fishes] Next Previous First
Protomyctophum bolini genome assembly, chromosome: 2	56.5	0.019	OZ001267
Pseudoliparis swirei [bony fishes] Next Previous First
PREDICTED: Pseudoliparis swirei nuclear receptor coactivator 3-like (LOC130199471), transcript variant X3, mRNA	56.5	0.019	XM_056422989
PREDICTED: Pseudoliparis swirei nuclear receptor coactivator 3-like (LOC130199471), transcript variant X2, mRNA	56.5	0.019	XM_056422988
PREDICTED: Pseudoliparis swirei nuclear receptor coactivator 3-like (LOC130199471), transcript variant X1, mRNA	56.5	0.019	XM_056422987
Eimeria acervulina [apicomplexans] Next Previous First
Eimeria acervulina hypothetical protein partial mRNA	56.5	0.019	XM_013392216
Epichloe typhina subsp. clarkii [ascomycete fungi] Next Previous First
Epichloe typhina subsp. clarkii strain 1605_22 chromosome 4	56.5	0.019	CP064807
Taurulus bubalis [bony fishes] Next Previous First
Taurulus bubalis genome assembly, chromosome: 11	56.5	0.019	OU342721
Zygotorulaspora mrakii [budding yeasts & others] Next Previous First
Zygotorulaspora mrakii transcription factor MCM1 (HG535_0C01170), partial mRNA	56.5	0.019	XM_037287601
Zygotorulaspora mrakii strain NRRL Y-6702 chromosome 3	56.5	0.019	CP058606

Taxonomy

Taxonomy Report
Taxonomy	Number of hits	Number of Organisms	Description
root	29	21
. Eukaryota	26	18
.. Opisthokonta	24	16
... Euteleostomi	21	14
.... Tetrapoda	7	4
..... Amniota	6	3
...... Euarchontoglires	5	2
....... Homo sapiens	4	1	Homo sapiens hits
....... Nothocricetulus migratorius	1	1	Nothocricetulus migratorius hits
...... Molothrus aeneus	1	1	Molothrus aeneus hits
..... Spea bombifrons	1	1	Spea bombifrons hits
.... Clupeocephala	14	10
..... Ctenosquamata	13	9
...... Acanthomorphata	10	6
....... Euacanthomorphacea	9	5
........ Percomorphaceae	7	4
......... Platichthys flesus	2	1	Platichthys flesus hits
......... Perciformes	5	3
.......... Echiichthys vipera	1	1	Echiichthys vipera hits
.......... Cottales	4	2
........... Pseudoliparis swirei	3	1	Pseudoliparis swirei hits
........... Taurulus bubalis	1	1	Taurulus bubalis hits
........ Poromitra crassiceps	2	1	Poromitra crassiceps hits
....... Merluccius merluccius	1	1	Merluccius merluccius hits
...... Myctophidae	3	3
....... Electrona antarctica	1	1	Electrona antarctica hits
....... Protomyctophum	2	2
........ Protomyctophum parallelum	1	1	Protomyctophum parallelum hits
........ Protomyctophum bolini	1	1	Protomyctophum bolini hits
..... Sprattus sprattus	1	1	Sprattus sprattus hits
... saccharomyceta	3	2
.... Epichloe typhina subsp. clarkii	1	1	Epichloe typhina subsp. clarkii hits
.... Zygotorulaspora mrakii	2	1	Zygotorulaspora mrakii hits
.. Chlorella sorokiniana	1	1	Chlorella sorokiniana hits
.. Eimeria acervulina	1	1	Eimeria acervulina hits
. artificial sequences	3	3
.. vectors	2	2
... Mammalian expression vector pCK146	1	1	Mammalian expression vector pCK146 hits
... Mammalian expression vector pCK65	1	1	Mammalian expression vector pCK65 hits
.. synthetic construct	1	1	synthetic construct hits

Filter Results

Sequences producing significant alignments